pcxle hoct3 4 addgene (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pcxle hoct3 4 addgene
Pcxle Hoct3 4 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcxle+hoct3+4+addgene/pCXLE-hOCT3%2F4+(Plasmid+%2327076)/pm41871099-678-0-1
Average 93 stars, based on 82 article reviews
Pcxle Hoct3 4 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcxle+hoct3+4+addgene/pCXLE-hOCT3%2F4+(Plasmid+%2327076)/pm41871099-678-0-1
Average 93 stars, based on 82 article reviews
pcxle hoct3 4 addgene - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
other:Article Title: Derivation of Pluripotent Stem Cells with In Vivo Embryonic and Extraembryonic Potency. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER FlowJo Ashland http://www.ashlandchamber.com/ ChamberDirectoryDetail.asp?MemberID= 2761&CID=284 Bio RAD CFX Connect Real-Time System BioRAD http://www.bio-rad.com/en-us/product/ cfx-connect-real-time-pcr-detection-system LSM 710 NLO & DuoScan System Zeiss N/A ZEN 2009 Zeiss https://www.zeiss.com/microscopy/int/ downloads/zen.html ImageJ NIH https://imagej.nih.gov/ij/ Prism 6 GraphPad Software https://www.graphpad.com DESeq2 Love et al., 2014 https://bioconductor.org/packages/release/bioc/ html/DESeq2.html Tophat Trapnell et al., 2009 https://ccb.jhu.edu/software/tophat/index.shtml BWA Li and Durbin, 2009 http://bio-bwa.sourceforge.net/ DAVID Bioinformatics Resources 6.7 Huang et al., 2009a, 2009b https://david-d.ncifcrf.gov/ R version 2.5.0 The R Foundation for Statistical Computing https://www.r-project.org/ Picard (version 2.6) Broad Institute https://broadinstitute.github.io/picard/ ngsplot Shen et al., 2014 https://github.com/shenlab-sinai/ngsplot EaSeq Lerdrup et al., 2016 http://easeq.net/ MACS2 2.1.0 Zhang et al., 2008 https://github.com/taoliu/MACS In Vivo:Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Control iPS cell line GM23280 Coriell Institute Cat #GM23280 Control iPS cell line NAS6 gift from Dr T. Kunath, University of Edinburgh; Ludtmann et al.60 N/A Control iPS cell line ND41866 Coriell Institute Cat #ND41866 Fibroblast cell line AF2 Seixas et al.8 N/A Fibroblast cell line AF3 Seixas et al.8 N/A Fibroblast cell line AF4 Seixas et al.8 N/A Human embryonic kidney 293T (HEK293T) cell line ATCC Cat #CRL-3216 Human neural stem cells (hNCS) Sun et al.61 N/A SCA37 iPS cell line AF2Cl21 This study N/A SCA37 iPS cell line AF2Cl4 This study N/A SCA37 iPS cell line AF3Cl7 This study N/A SCA37 iPS cell line AF4Cl32 This study N/A Experimental models: organisms/strains Transgenic zebrafish line gSA2AzGFF152B; UAS:GFP Kindly gift by Drs. Kawakami and Hibi, Japan; Takeuchi et al.47; Asakawa et al.62 N/A Transgenic zebrafish line Tg(Frag1:EGFP) This study N/A Transgenic zebrafish line Tg(Frag3:EGFP) This study N/A Transgenic zebrafish line Tg(FragT:EGFP) This study N/A Zebrafish WTAB This study N/A Oligonucleotides Primers for 4C-seq are provided in Table S2 This study N/A Primers for cloning FragT and subfragments in pMCS or Topo8 are provided in Table S2 This study N/A Primers for cloning TK promoter in pGL4.23-GW are provided in Table S2 This study N/A Primers for genotyping of HEK293T cell clones are provided in Table S2 This study N/A Primers for qPCR are provided in Table S2 This study N/A SgRNAs used for FragT deletion are provided in Table S3 This study N/A Recombinant DNA .. Activity Assay:Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Control iPS cell line GM23280 Coriell Institute Cat #GM23280 Control iPS cell line NAS6 gift from Dr T. Kunath, University of Edinburgh; Ludtmann et al.60 N/A Control iPS cell line ND41866 Coriell Institute Cat #ND41866 Fibroblast cell line AF2 Seixas et al.8 N/A Fibroblast cell line AF3 Seixas et al.8 N/A Fibroblast cell line AF4 Seixas et al.8 N/A Human embryonic kidney 293T (HEK293T) cell line ATCC Cat #CRL-3216 Human neural stem cells (hNCS) Sun et al.61 N/A SCA37 iPS cell line AF2Cl21 This study N/A SCA37 iPS cell line AF2Cl4 This study N/A SCA37 iPS cell line AF3Cl7 This study N/A SCA37 iPS cell line AF4Cl32 This study N/A Experimental models: organisms/strains Transgenic zebrafish line gSA2AzGFF152B; UAS:GFP Kindly gift by Drs. Kawakami and Hibi, Japan; Takeuchi et al.47; Asakawa et al.62 N/A Transgenic zebrafish line Tg(Frag1:EGFP) This study N/A Transgenic zebrafish line Tg(Frag3:EGFP) This study N/A Transgenic zebrafish line Tg(FragT:EGFP) This study N/A Zebrafish WTAB This study N/A Oligonucleotides Primers for 4C-seq are provided in Table S2 This study N/A Primers for cloning FragT and subfragments in pMCS or Topo8 are provided in Table S2 This study N/A Primers for cloning TK promoter in pGL4.23-GW are provided in Table S2 This study N/A Primers for genotyping of HEK293T cell clones are provided in Table S2 This study N/A Primers for qPCR are provided in Table S2 This study N/A SgRNAs used for FragT deletion are provided in Table S3 This study N/A Recombinant DNA .. Recombinant:Article Title: DNAJB6, a Key Factor in Neuronal Sensitivity to Amyloidogenesis. Article Snippet: .. S100b TCTTAGAGGAAATCAAAGAGCAGG GAATTCCTGGAAGTCACATTCG Map2 CCCAAGCTAAAGTTGGTTCTC GGCTGTCAATCTTGACATTACC Tubb3 GGCCTCTTCTCACAAGTACG GAAGAGATGTCCAAAGGCCC pcDNA5/FRT/TO V5-DNAJB6b (F89I) F89I-F: CAGTCCATTTGAAATTGGCTTCAC F89I-R: GTGAAGCCAATTTCAAATGGACTG pcDNA5/FRT/TO V5-DNAJB6b (F93L) F93L-F: GGCTTCACACTCCGTAACCCAG F93L-R: CTGGGTTACGGAGTGTGAAGCC pcDNA5/FRT/TO V5-DNAJB6b (P96R) P96R-F: CATTCCGTAACCGAGATGATGTC P96R-R: GACATCATCTCGGTTACGGAATG Recombinant DNA pCXLE-EGFP Addgene Cat#27082 CRISPR:Article Title: DNAJB6, a Key Factor in Neuronal Sensitivity to Amyloidogenesis. Article Snippet: .. S100b TCTTAGAGGAAATCAAAGAGCAGG GAATTCCTGGAAGTCACATTCG Map2 CCCAAGCTAAAGTTGGTTCTC GGCTGTCAATCTTGACATTACC Tubb3 GGCCTCTTCTCACAAGTACG GAAGAGATGTCCAAAGGCCC pcDNA5/FRT/TO V5-DNAJB6b (F89I) F89I-F: CAGTCCATTTGAAATTGGCTTCAC F89I-R: GTGAAGCCAATTTCAAATGGACTG pcDNA5/FRT/TO V5-DNAJB6b (F93L) F93L-F: GGCTTCACACTCCGTAACCCAG F93L-R: CTGGGTTACGGAGTGTGAAGCC pcDNA5/FRT/TO V5-DNAJB6b (P96R) P96R-F: CATTCCGTAACCGAGATGATGTC P96R-R: GACATCATCTCGGTTACGGAATG Recombinant DNA pCXLE-EGFP Addgene Cat#27082 Plasmid Preparation:Article Title: DNAJB6, a Key Factor in Neuronal Sensitivity to Amyloidogenesis. Article Snippet: .. S100b TCTTAGAGGAAATCAAAGAGCAGG GAATTCCTGGAAGTCACATTCG Map2 CCCAAGCTAAAGTTGGTTCTC GGCTGTCAATCTTGACATTACC Tubb3 GGCCTCTTCTCACAAGTACG GAAGAGATGTCCAAAGGCCC pcDNA5/FRT/TO V5-DNAJB6b (F89I) F89I-F: CAGTCCATTTGAAATTGGCTTCAC F89I-R: GTGAAGCCAATTTCAAATGGACTG pcDNA5/FRT/TO V5-DNAJB6b (F93L) F93L-F: GGCTTCACACTCCGTAACCCAG F93L-R: CTGGGTTACGGAGTGTGAAGCC pcDNA5/FRT/TO V5-DNAJB6b (P96R) P96R-F: CATTCCGTAACCGAGATGATGTC P96R-R: GACATCATCTCGGTTACGGAATG Recombinant DNA pCXLE-EGFP Addgene Cat#27082 Software:Article Title: DNAJB6, a Key Factor in Neuronal Sensitivity to Amyloidogenesis. Article Snippet: .. S100b TCTTAGAGGAAATCAAAGAGCAGG GAATTCCTGGAAGTCACATTCG Map2 CCCAAGCTAAAGTTGGTTCTC GGCTGTCAATCTTGACATTACC Tubb3 GGCCTCTTCTCACAAGTACG GAAGAGATGTCCAAAGGCCC pcDNA5/FRT/TO V5-DNAJB6b (F89I) F89I-F: CAGTCCATTTGAAATTGGCTTCAC F89I-R: GTGAAGCCAATTTCAAATGGACTG pcDNA5/FRT/TO V5-DNAJB6b (F93L) F93L-F: GGCTTCACACTCCGTAACCCAG F93L-R: CTGGGTTACGGAGTGTGAAGCC pcDNA5/FRT/TO V5-DNAJB6b (P96R) P96R-F: CATTCCGTAACCGAGATGATGTC P96R-R: GACATCATCTCGGTTACGGAATG Recombinant DNA pCXLE-EGFP Addgene Cat#27082 Lysis:Article Title: Derivation of Pluripotent Stem Cells with In Vivo Embryonic and Extraembryonic Potency. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EmbryoMax KSOM Embryo Culture Millipore Cat# MR-020P-5F EmbryoMax M2 medium Millipore Cat# MR-015-D Triton X-100 Sigma-Aldrich Cat# T8787 Trizol (TRI) Reagent Sigma-Aldrich Cat# T9424 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Paraformaldehyde DingGuo Cat# AR-0211 DAPI Roche Life Science Cat# 10236276001 Collagenase, Type IV, powder Thermo Fisher Scientific Cat# 17104019 Dispase II, powder Thermo Fisher Scientific Cat# 17105041 TWEEN 20 Sigma-Aldrich Cat# P1379 Tripelennamine HCl Selleckchem Cat# S3146 Desloratadine Selleckchem Cat# S4012 BSI 201 Tocris Cat# 5817 Nicotinamide Tocris Cat# 4106 SB 203580 Tocris Cat# 1202 SP 600125 Tocris Cat# 1496 Matrigel matrix Corning Cat# 354248 Leukemia Inhibitory Factor, recombinant human Millipore Cat# LIF1050 Critical Commercial Assays 4D-Nucleofector System Lonza Cat# AAF-1002B; AAF-1002X; AAF-1002Y P3 Primary Cell 4D-Nucleofector Kit L Lonza Cat# V4XP-3024 RNeasy Mini Kit QIAGEN Cat# 74106 QIAquick PCR Purification Kit QIAGEN Cat# 28104 Dual-Luciferase Reporter Assay System Promega Cat# E1960 DNeasy Blood & Tissue Kit QIAGEN Cat# 69506 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 KAPA SYBR FAST Universal 2x qPCR Master Mix KAPA Biosystems Cat# KK4601 Halt Protease and Phosphatase Inhibitor SingleUse Cocktail, EDTA-Free Thermo Fisher Scientific Cat# 78443 Halt Phosphatase Inhibitor Single-Use Cocktail Thermo Fisher Scientific Cat# 78428 2x EasyTaq PCR SuperMix Transgen Biotech Cat# AS111 TransScript First-Strand cDNA Synthesis SuperMix Transgen Biotech Cat# AT301 NEBNext Ultra DNA Library Prep Kit for Illumina NEB England BioLabs Cat# E7370S NEBNext Ultra RNA Library Prep Kit for Illumina NEB England BioLabs Cat# E7530L BioCoat Matrigel Invasion Chambers with 8.0 mm PET Membrane in two 24 Well Plates, 12/Pack, 24/Case Corning Cat# 354480 Immobilon-P Membrane, PVDF, 0.45 mm Millipore Cat# IPVH07850 RNase-Free DNase Set QIAGEN Cat# 79254 TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Transgen Biotech Cat# AT311 NuPAGE Novex 10% Bis-Tris Gel Thermo Fisher Scientific Cat# NP0315BOX NuPAGE Novex 12% Bis-Tris Gel Thermo Fisher Scientific Cat# NP0341PK2 NuPAGE Transfer Buffer (20X) Thermo Fisher Scientific Cat# NP0006 NuPAGE MOPS SDS Running Buffer (for Bis-Tris Gels only) (20X) (500 ml) Thermo Fisher Scientific Cat# NP0001 (Continued on next page) e3 Cell 169, 243–257.e1–e14, April 6, 2017 .. REAGENT or RESOURCE SOURCE IDENTIFIER BeyoECL Star Beyotime Technology Cat# P0018A RIPA lysis buffer Beyotime Technology Cat# P0013B Deposited Data RNA-seq data & ChIP-seq data This study GEO: GSE89303 Experimental Models: Cell Lines H1 (WA01) WiCell NIH: hESC-10-0043 H9 (WA09) WiCell NIH: hESC-10-0062 0227E This study N/A HSF1 Gift from Kehkooi Kee NIH: UC01 HSF6 Gift from Kehkooi Kee NIH: UC06 Primary human embryonic fibroblast This study N/A Primary mouse embryonic fibroblast This study N/A TT2 RIKEN BioResource Center Stock No.: AES0014 Cell lines established in this study are summarized in Table S2 This study N/A Experimental Models: Organisms/Strains C57BL/6J-Tg(GOFGFP)11lmeg/Rbrc(OG) mice RIKEN BioResource Center Stock No.: RBRC00771 C57BL/6(C57) mice Beijing Vital River Laboratory Animal Technology Stock No.: 213 ICR mice Beijing Vital River Laboratory Animal Technology Stock No.: 201 129 mice Beijing Vital River Laboratory Animal Technology Stock No.: 217 DBA2 mice Beijing Vital River Laboratory Animal Technology Stock No.: 214 NPG (NOD-Prkdcscid Il2rgtm1/Vst mice Beijing Vitalstar Biotechnology Stock No.: VS-AM-001 B6.Tg(Sox2-cre)1Amc/J mice The Jackson Laboratory Stock No.: 008454 B6.Cg-Gt (ROSA) 26Sortm14(CAG-Tdtomato)Hze/J mice The Jackson Laboratory Stock No.: 007914 Oligonucleotides Oligonucleotides are summarized in Table S6 This study N/A Recombinant DNA pGL4.74 [hRluc/TK] Promega Cat# E6921 pGL3-human OCT4 DE-SV40-Luc Addgene Cat# 52414 RNA Sequencing:Article Title: Derivation of Pluripotent Stem Cells with In Vivo Embryonic and Extraembryonic Potency. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EmbryoMax KSOM Embryo Culture Millipore Cat# MR-020P-5F EmbryoMax M2 medium Millipore Cat# MR-015-D Triton X-100 Sigma-Aldrich Cat# T8787 Trizol (TRI) Reagent Sigma-Aldrich Cat# T9424 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Paraformaldehyde DingGuo Cat# AR-0211 DAPI Roche Life Science Cat# 10236276001 Collagenase, Type IV, powder Thermo Fisher Scientific Cat# 17104019 Dispase II, powder Thermo Fisher Scientific Cat# 17105041 TWEEN 20 Sigma-Aldrich Cat# P1379 Tripelennamine HCl Selleckchem Cat# S3146 Desloratadine Selleckchem Cat# S4012 BSI 201 Tocris Cat# 5817 Nicotinamide Tocris Cat# 4106 SB 203580 Tocris Cat# 1202 SP 600125 Tocris Cat# 1496 Matrigel matrix Corning Cat# 354248 Leukemia Inhibitory Factor, recombinant human Millipore Cat# LIF1050 Critical Commercial Assays 4D-Nucleofector System Lonza Cat# AAF-1002B; AAF-1002X; AAF-1002Y P3 Primary Cell 4D-Nucleofector Kit L Lonza Cat# V4XP-3024 RNeasy Mini Kit QIAGEN Cat# 74106 QIAquick PCR Purification Kit QIAGEN Cat# 28104 Dual-Luciferase Reporter Assay System Promega Cat# E1960 DNeasy Blood & Tissue Kit QIAGEN Cat# 69506 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 KAPA SYBR FAST Universal 2x qPCR Master Mix KAPA Biosystems Cat# KK4601 Halt Protease and Phosphatase Inhibitor SingleUse Cocktail, EDTA-Free Thermo Fisher Scientific Cat# 78443 Halt Phosphatase Inhibitor Single-Use Cocktail Thermo Fisher Scientific Cat# 78428 2x EasyTaq PCR SuperMix Transgen Biotech Cat# AS111 TransScript First-Strand cDNA Synthesis SuperMix Transgen Biotech Cat# AT301 NEBNext Ultra DNA Library Prep Kit for Illumina NEB England BioLabs Cat# E7370S NEBNext Ultra RNA Library Prep Kit for Illumina NEB England BioLabs Cat# E7530L BioCoat Matrigel Invasion Chambers with 8.0 mm PET Membrane in two 24 Well Plates, 12/Pack, 24/Case Corning Cat# 354480 Immobilon-P Membrane, PVDF, 0.45 mm Millipore Cat# IPVH07850 RNase-Free DNase Set QIAGEN Cat# 79254 TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Transgen Biotech Cat# AT311 NuPAGE Novex 10% Bis-Tris Gel Thermo Fisher Scientific Cat# NP0315BOX NuPAGE Novex 12% Bis-Tris Gel Thermo Fisher Scientific Cat# NP0341PK2 NuPAGE Transfer Buffer (20X) Thermo Fisher Scientific Cat# NP0006 NuPAGE MOPS SDS Running Buffer (for Bis-Tris Gels only) (20X) (500 ml) Thermo Fisher Scientific Cat# NP0001 (Continued on next page) e3 Cell 169, 243–257.e1–e14, April 6, 2017 .. REAGENT or RESOURCE SOURCE IDENTIFIER BeyoECL Star Beyotime Technology Cat# P0018A RIPA lysis buffer Beyotime Technology Cat# P0013B Deposited Data RNA-seq data & ChIP-seq data This study GEO: GSE89303 Experimental Models: Cell Lines H1 (WA01) WiCell NIH: hESC-10-0043 H9 (WA09) WiCell NIH: hESC-10-0062 0227E This study N/A HSF1 Gift from Kehkooi Kee NIH: UC01 HSF6 Gift from Kehkooi Kee NIH: UC06 Primary human embryonic fibroblast This study N/A Primary mouse embryonic fibroblast This study N/A TT2 RIKEN BioResource Center Stock No.: AES0014 Cell lines established in this study are summarized in Table S2 This study N/A Experimental Models: Organisms/Strains C57BL/6J-Tg(GOFGFP)11lmeg/Rbrc(OG) mice RIKEN BioResource Center Stock No.: RBRC00771 C57BL/6(C57) mice Beijing Vital River Laboratory Animal Technology Stock No.: 213 ICR mice Beijing Vital River Laboratory Animal Technology Stock No.: 201 129 mice Beijing Vital River Laboratory Animal Technology Stock No.: 217 DBA2 mice Beijing Vital River Laboratory Animal Technology Stock No.: 214 NPG (NOD-Prkdcscid Il2rgtm1/Vst mice Beijing Vitalstar Biotechnology Stock No.: VS-AM-001 B6.Tg(Sox2-cre)1Amc/J mice The Jackson Laboratory Stock No.: 008454 B6.Cg-Gt (ROSA) 26Sortm14(CAG-Tdtomato)Hze/J mice The Jackson Laboratory Stock No.: 007914 Oligonucleotides Oligonucleotides are summarized in Table S6 This study N/A Recombinant DNA pGL4.74 [hRluc/TK] Promega Cat# E6921 pGL3-human OCT4 DE-SV40-Luc Addgene Cat# 52414 Chromatin Immunoprecipitation:Article Title: Derivation of Pluripotent Stem Cells with In Vivo Embryonic and Extraembryonic Potency. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EmbryoMax KSOM Embryo Culture Millipore Cat# MR-020P-5F EmbryoMax M2 medium Millipore Cat# MR-015-D Triton X-100 Sigma-Aldrich Cat# T8787 Trizol (TRI) Reagent Sigma-Aldrich Cat# T9424 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Paraformaldehyde DingGuo Cat# AR-0211 DAPI Roche Life Science Cat# 10236276001 Collagenase, Type IV, powder Thermo Fisher Scientific Cat# 17104019 Dispase II, powder Thermo Fisher Scientific Cat# 17105041 TWEEN 20 Sigma-Aldrich Cat# P1379 Tripelennamine HCl Selleckchem Cat# S3146 Desloratadine Selleckchem Cat# S4012 BSI 201 Tocris Cat# 5817 Nicotinamide Tocris Cat# 4106 SB 203580 Tocris Cat# 1202 SP 600125 Tocris Cat# 1496 Matrigel matrix Corning Cat# 354248 Leukemia Inhibitory Factor, recombinant human Millipore Cat# LIF1050 Critical Commercial Assays 4D-Nucleofector System Lonza Cat# AAF-1002B; AAF-1002X; AAF-1002Y P3 Primary Cell 4D-Nucleofector Kit L Lonza Cat# V4XP-3024 RNeasy Mini Kit QIAGEN Cat# 74106 QIAquick PCR Purification Kit QIAGEN Cat# 28104 Dual-Luciferase Reporter Assay System Promega Cat# E1960 DNeasy Blood & Tissue Kit QIAGEN Cat# 69506 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 KAPA SYBR FAST Universal 2x qPCR Master Mix KAPA Biosystems Cat# KK4601 Halt Protease and Phosphatase Inhibitor SingleUse Cocktail, EDTA-Free Thermo Fisher Scientific Cat# 78443 Halt Phosphatase Inhibitor Single-Use Cocktail Thermo Fisher Scientific Cat# 78428 2x EasyTaq PCR SuperMix Transgen Biotech Cat# AS111 TransScript First-Strand cDNA Synthesis SuperMix Transgen Biotech Cat# AT301 NEBNext Ultra DNA Library Prep Kit for Illumina NEB England BioLabs Cat# E7370S NEBNext Ultra RNA Library Prep Kit for Illumina NEB England BioLabs Cat# E7530L BioCoat Matrigel Invasion Chambers with 8.0 mm PET Membrane in two 24 Well Plates, 12/Pack, 24/Case Corning Cat# 354480 Immobilon-P Membrane, PVDF, 0.45 mm Millipore Cat# IPVH07850 RNase-Free DNase Set QIAGEN Cat# 79254 TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Transgen Biotech Cat# AT311 NuPAGE Novex 10% Bis-Tris Gel Thermo Fisher Scientific Cat# NP0315BOX NuPAGE Novex 12% Bis-Tris Gel Thermo Fisher Scientific Cat# NP0341PK2 NuPAGE Transfer Buffer (20X) Thermo Fisher Scientific Cat# NP0006 NuPAGE MOPS SDS Running Buffer (for Bis-Tris Gels only) (20X) (500 ml) Thermo Fisher Scientific Cat# NP0001 (Continued on next page) e3 Cell 169, 243–257.e1–e14, April 6, 2017 .. REAGENT or RESOURCE SOURCE IDENTIFIER BeyoECL Star Beyotime Technology Cat# P0018A RIPA lysis buffer Beyotime Technology Cat# P0013B Deposited Data RNA-seq data & ChIP-seq data This study GEO: GSE89303 Experimental Models: Cell Lines H1 (WA01) WiCell NIH: hESC-10-0043 H9 (WA09) WiCell NIH: hESC-10-0062 0227E This study N/A HSF1 Gift from Kehkooi Kee NIH: UC01 HSF6 Gift from Kehkooi Kee NIH: UC06 Primary human embryonic fibroblast This study N/A Primary mouse embryonic fibroblast This study N/A TT2 RIKEN BioResource Center Stock No.: AES0014 Cell lines established in this study are summarized in Table S2 This study N/A Experimental Models: Organisms/Strains C57BL/6J-Tg(GOFGFP)11lmeg/Rbrc(OG) mice RIKEN BioResource Center Stock No.: RBRC00771 C57BL/6(C57) mice Beijing Vital River Laboratory Animal Technology Stock No.: 213 ICR mice Beijing Vital River Laboratory Animal Technology Stock No.: 201 129 mice Beijing Vital River Laboratory Animal Technology Stock No.: 217 DBA2 mice Beijing Vital River Laboratory Animal Technology Stock No.: 214 NPG (NOD-Prkdcscid Il2rgtm1/Vst mice Beijing Vitalstar Biotechnology Stock No.: VS-AM-001 B6.Tg(Sox2-cre)1Amc/J mice The Jackson Laboratory Stock No.: 008454 B6.Cg-Gt (ROSA) 26Sortm14(CAG-Tdtomato)Hze/J mice The Jackson Laboratory Stock No.: 007914 Oligonucleotides Oligonucleotides are summarized in Table S6 This study N/A Recombinant DNA pGL4.74 [hRluc/TK] Promega Cat# E6921 pGL3-human OCT4 DE-SV40-Luc Addgene Cat# 52414 |